MFEprimer-3.1#
Big change from v3.0
Major changes from v3.0#
- merge several tools into one single execute file
mfeprimer - support major platforms: Linux, Mac and Windows
- bug fixed and faster than v3.0
- fix thermodynamics calculation bugs for dimers and hairpins
- local web server version is available
Summary of different versions#
Before getting started, I’d like to make a summary for different versions. Please choose the right version for you.
| Title | web server by the author | command-line | local web server |
|---|---|---|---|
| primer number | <= 50 | no limit | usually <= 50 |
| database | pre-indexed by the author | no limit | no limit |
| user interface | graphic and easy to use | terminal and requires essential Linux skills | graphic and easy to use |
| users from | worldwide | the owner | usually all members of the institution |
| workflow | no | yes and can be integrated into user defined primer design workflows | no |
1. Web servers maintained by the author#
2. Command-line version#
Install#
- Please download the right version for your machine: https://github.com/quwubin/MFEprimer-3.0/releases (take Linux version as an example).
- Uncompress the file.
- Make sure the file has the execute permission.
- Run with option “-h” to get help message. You can rename the file to
mfeprimeras you wish.
# download the executable mfeprimer file
wget -c https://github.com/quwubin/MFEprimer-3.0/releases/download/v3.1.0/mfeprimer-3.1.0-linux-amd64.gz
# uncompress the file
gzip -d mfeprimer-3.1.0-linux-amd64.gz
# make it executable
chmod +x mfeprimer-3.1.0-linux-amd64
# test it
./mfeprimer-3.1.0-linux-amd64 -h
MFEprimer-3.1.0, a functional primer quality control program for checking
non-specific amplicons, dimers, hairpins and others.
Web site: https://www.mfeprimer.com/
Cite: Wang, K., Li, H., Xu, Y., Shao, Q., Yi, J., Wang, R., … Qu, W. (2019).
MFEprimer-3.0: quality control for PCR primers. Nucleic Acids Research.
https://doi.org/10.1093/nar/gkz351.
Usage:
mfeprimer [flags]
mfeprimer [command]
Available Commands:
dimer analysis primer dimers
hairpin analysis primer hairpins
help Help about any command
index index fasta file for mfeprimer
indexcmp Compare the old and the new index file, return false when they are not same
spec analysis specificity of primers
version print version number
Flags:
-b, --bind print specific and nonspecific binding sites and patterns for each primer
-d, --db strings [*] database indexed for specificity check: -d hg19.fa -d mrna.fa
--diva float concentration of divalent cations [mM] (default 1.5)
--dntp float concentration of dNTPs [mM] (default 0.25)
-h, --help help for mfeprimer
-i, --in string [*] a file contains primer sequences in fasta format
-j, --json output in json format
-k, --kvalue int k value for format, defaut is 9 (default 9)
-S, --maxSize int max product size for the predicted amplicons [bp] (default 2000)
-s, --minSize int min product size for the predicted amplicons [bp]
--misEnd int mis-match ends to the position of 3' end, 9 (kvalue) for the 9th base from the 3'end (default 9)
--misMatch int max allowed mismatches between kmer and its binding sites
--misStart int mis-match starts from the position of 3' end, 1 is for the very end of primer. (default 1)
--mono float concentration of monovalent cations [mM] (default 50)
--oligo float concentration of annealing oligos [nM] (default 50)
-o, --out string output file name, e.g., primer.mfe.txt
--snp string SNP file name in bed format, e.g., dbsnp151.bed
-t, --tm float tm cutoff value to filter the amplicons (default 30)
Use "mfeprimer [command] --help" for more information about a command.In v3.1.0, I make
index,dimer,hairpinas sub-commands tomfeprimer, each sub-command has their own arguments and options to set.I manually tested the Mac and Linux version, and I will find time to test the Windows version.
Usage#
I’d like to do some examples with sample files, let’s prepare the test files:
# make a test directory
mkdir test
cd test
# chrM.fa as database
wget -c https://github.com/quwubin/MFEprimer-3.0/raw/master/chrM.fa
# p.fa test primer sequences in fasta format
wget -c https://github.com/quwubin/MFEprimer-3.0/raw/master/p.fa
# snp in bed format to check whether a primers bind to a snp site
wget -c https://github.com/quwubin/MFEprimer-3.0/raw/master/snp.bed
# make a softlink
ln -s ../mfeprimer-3.1.0-linux-amd64 mfeprimer The file tree is:
tree .
.
├── chrM.fa
├── mfeprimer -> ../mfeprimer-3.1.0-linux-amd64
├── p.fa
└── snp.bedIndex databases#
./mfeprimer index -i chrM.faAfter index, the file tree is:
tree .
.
├── chrM.fa
├── chrM.fa.fai
├── chrM.fa.json
├── chrM.fa.log
├── chrM.fa.primerqc
├── chrM.fa.primerqc.fai
├── mfeprimer -> ../mfeprimer-3.1.0-linux-amd64
├── p.fa
└── snp.bed
mfeprimer indexwill add 5 files with suffixes: “.fai”, “.json”, “.primerqc”, “.primerqc.fai” and “.log”.
Run mfeprimer for full quality control#
# run mfeprimer
./mfeprimer -i p.fa -d chrM.faWithout “-o” options, the result will print to the screen:
MFEprimer-3.0 Primer Quality Reports (2019-10-17 11:29:18)
Primer ID Sequence (5'-->3') Length GC Tm Dg Binding Number
(bp) (%) (°C) (kcal/mol) Plus Minus
p1 CTACAACCCCACCACGTACC 20 60.00 60.55 -22.23 0 0
p2 CGTTACACACTTTGCGGCAA 20 50.00 60.47 -22.43 0 0
p3 CTTAAATAGGGACCTGTATGAATGGCTC 28 42.86 61.98 -27.11 2 1
p4 CCGAAATTTTTAATGCAGGTTTGGTAGT 28 35.71 61.97 -27.14 0 1
p5 GGACACTCTATGGGAAAGAGTGTCC 25 52.00 62.91 -26.07 0 1
Hairpin List (1)
Hairpin 1: p5
Score: 9, Tm = 26.56 °C, Delta G = -4.48 kcal/mol
/////////-------\\\\\\\\\
GGACACTCTATGGGAAAGAGTGTCC
Dimer List (1)
Dimer 1: p2 x p2
Score: 7, Tm = 14.55 °C, Delta G = -6.09 kcal/mol
CGTTACACACTTTGCGGCAA
::::.::::
AACGGCGTTTCACACATTGC
Descriptions of [ 1 ] potential amplicons
AmpID HitID Size FpTm RpTm FpDg RpDg
(bp) (°C) (°C) kcal/mol kcal/mol
1 chrM 200 61.93 62.67 -27.40 -28.08
Amplicon details
Amp 1: p3 + p4 ==> chrM
Size = 200 bp, GC content = 43.50%
F: Tm = 61.93 °C, Delta G = -27.40 kcal/mol
R: Tm = 62.67 °C, Delta G = -28.08 kcal/mol
Binding sites: 2612(28/28) ... 2811(28/28)
>>>p3
1 28
5' CTTAAATAGGGACCTGTATGAATGGCTC 3'
:::::::::::::::::::::::::::: 2811
5' CTTAAATAGGGACCTGTATGAATGGCTCcacgagggttcagct...acccacaggtcctaaACTACCAAACCTGCATTAAAAATTTCGG 3'
2612 ::::::::::::::::::::::::::::
3' ACTACCAAACCTGCATTAAAAATTTCGG 5'
28 1
p4<<<
>Amp_1 p3 + p4 ==> chrM
CTTAAATAGGGACCTGTATGAATGGCTCcacgagggttcagctgtctcttacttttaaccagtgaaattgacctgcccgt
gaagaggcgggcataacacagcaagacgagaagaccctatggagctttaatttattaatgcaaacagtacctaacaaacc
cacaggtcctaaACTACCAAACCTGCATTAAAAATTTCGG
Parameters
Primer file: p.fa
Database: chrM.fa
Kvalue: 9
MisMatch: 0
Tm cutoff (°C): 30.00
Amplicon min size (bp): 0
Amplicon max size (bp): 2000
SNP:
Monovalent cations [mM]: 50.00
Divalent cations [mM]: 1.50
dNTPs [mM]: 0.25
Annealing oligos [nM]: 50.00
Cite
Kun Wang, Haiwei Li, Yue Xu, Qianzhi Shao, Jianming Yi, Ruichao Wang, Wanshi Cai, Xingyi Hang,
Chenggang Zhang, Haoyang Cai, Wubin Qu, MFEprimer-3.0: quality control for PCR primers,
Nucleic Acids Research, Volume 47, Issue W1, 02 July 2019, Pages W610–W613,
https://doi.org/10.1093/nar/gkz351
Web & Contact
https://www.mfeprimer.com
Wubin Qu <quwubin@gmail.com>
Total time used: 81.641035ms.The relation between mfeprimer and its sub-commands: mfeprimer do a full quality control for primers for specificity, binding sites, dimers and hairpins. While, spec only for specificity, dimer is only for dimers and hairpin is only for hairpins, as their names indicated. The sub-commands have more options to control the behavious. mfeprimer only have default parameters for dimers and hairpins.
Run mfeprimer spec for specificity#
./mfeprimer spec -i p.fa -d chrM.fa
Run mfeprimer dimer for dimers#
./mfeprimer dimer -i p.faRun mfeprimer hairpin for hairpins#
./mfeprimer hairpin -i p.fa3. Local web server#
Download and install#
- Please download the right version for your machine: https://github.com/quwubin/MFEprimer-3.0/releases (take the Mac version as an example).
- Uncompress the file.
- test it.
# download the executable mfeprimer-web file
wget -c https://github.com/quwubin/MFEprimer-3.0/releases/download/v3.1.1/mfeprimer-web-3.1.1-darwin-amd64.tar.gz
# uncompress the file
tar zxvf mfeprimer-web-3.1.1-darwin-amd64.tar.gz
# The file tree is:
tree -L 2
.
├── conf
│ └── app.conf
├── mfedb
│ ├── chrM.fa
│ ├── chrM.fa.fai
│ ├── chrM.fa.json
│ ├── chrM.fa.log
│ ├── chrM.fa.primerqc
│ └── chrM.fa.primerqc.fai
├── mfeprimer-web
├── static
│ ├── css
│ ├── fonts
│ ├── img
│ └── js
└── views
├── dimer
├── hairpin
├── layout.html
├── seq
└── spec
# test it
./mfeprimer-web
# open your browser and enter the following address, and you will see the default page.
http://localhost:8080/
Configure the server#
Open the “conf/app.conf”, change the corresponding item following the references in the file.
Add database#
There is an example database named “chrM.fa” in “mfedb” directory. You can place any database here
and index the database with command mfeprimer index -i dbname.fasta.