Human pan-genome primer check#

https://m4.igenetech.com/panspec/

Example result#

Live example across 97 HPRC assemblies using classic HLA-DRB exon 2 primers AMP-A / AMP-B (~274 bp):

While the job is running, the result page polls a status API and updates progress / the assembly table in place (no full-page reload). When finished it shows coverage % and the per-assembly OK / Multi / No amp table. You can bookmark this link to see a real pan-genome coverage report.

Default primers and literature source#

The web form defaults to the same primer pair. Sequences are the 11th International Histocompatibility Workshop (IHW) standard primers DRBAMP-A / DRBAMP-B, as listed in Table 1 of:

Bhattacharya S, Rathore A, Saha A, et al.
HLA class II SNP interactions and the association with type 1 diabetes mellitus in Bengali speaking patients of Eastern India.
J Biomed Sci. 2013;20:12.
PMID 23441825 · DOI 10.1186/1423-0127-20-12

>HLA-DRB-AMP-A
CCCCACAGCACGTTTCTTG
>HLA-DRB-AMP-B
CCGCTGCACTGTGAAGCTCT

Introduction#

Human pan-genome primer check evaluates whether a single PCR primer pair can amplify across a fixed set of 97 human pan-genome assemblies from the Human Pangenome Reference Consortium (HPRC).

Unlike the general Specificity Check (user-selected background databases) or Coverage Analysis for Microbes (viral / microbial multi-FASTA collections), this module:

  1. Accepts exactly one primer pair (forward + reverse)
  2. Runs MFEprimer specificity against every indexed HPRC assembly in the set
  3. Returns a coverage summary: covered / missed rate, plus a per-assembly table (OK / Multi / No amp)

Typical uses:

  • Check that diagnostic or panel primers remain functional across human haplotype diversity
  • Spot assemblies where the pair fails or produces multiple amplicons
  • Download a summary.tsv for further review

Assemblies#

Genome assemblies are from HPRC / Ensembl. Browse and download sources:

How to use#

  1. Open https://m4.igenetech.com/panspec/
  2. Paste one forward and one reverse primer (FASTA or plain sequences)
  3. Adjust Tm min and product size window if needed (3′ mismatch is fixed at 0)
  4. Click Run and bookmark the task link — scanning ~97 assemblies may take several minutes
  5. Review coverage %, then inspect the per-assembly table or download summary.tsv

Status meanings#

Status Meaning
OK Exactly one amplicon within the Size / Tm window
Multi More than one amplicon in the window (still counted as covered)
No amp No qualifying amplicon
Error Analysis failed for that assembly

Coverage rate = assemblies with OK or Multi / total assemblies.

MP-Ref Forward